You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
rnjB [2018-11-15 10:26:11]
Molecular weight
56.67 kDa
Function
RNA processing and degradation
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
1,749,418 → 1,751,085
Phenotypes of a mutant
growth advantage at low pressure and at 27°C at normal pressure (has been selected at low pressure) PubMed The protein
Catalyzed reaction/ biological activity
endoribonuclease, involved in processing of thrS mRNA Protein family
Paralogous protein(s)
Structure
3ZQ4, RNase J1, 49% identity, 81% similarity PubMed Localization
cytoplasm, colocalizes with the ribosomes PubMed Expression and Regulation
Biological materials
Mutant
MGNA-B114 (ymfA::erm), available at the NBRP B. subtilis, JapanGP1113 (rnjB::miniTn10 spc), available in Jörg Stülke's labGP1291 (ΔrnjB::cat), available in Jörg Stülke's labBKE16780 (ΔrnjB::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAAAATCTATATCCTCCTAG, downstream forward: _UP4_TAATGACTGACTAAAGACCGBKK16780 (ΔrnjB::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAAAATCTATATCCTCCTAG, downstream forward: _UP4_TAATGACTGACTAAAGACCG Expression vectors
GP1687, chromosomal expression of rnjB-Strep::kan in B. subtilis, available in Jörg Stülke's labGP1724, chromosomal expression of rnjB-Strep::spc in B. subtilis, based on pGP1389, available in Jörg Stülke's labpGP1438: IPTG inducible expression, purification in E. coli with N-terminal His-tag, in pWH844, available in Jörg Stülke's labpGP1440: IPTG inducible expression, purification in E. coli with N-terminal Strep-tag, in pGP172, available in Jörg Stülke's lab LacZ fusion
GFP fusion
GP1695 (in pHJS-105 PubMed), expression of rnjB-sfGFP::spc under a xylose-inducible promoter in B. subtilis, available in Jörg Stülke's lab PubMedGP1699 (in pBP43), expression of rnjB-GFP::spc under the native promoter, available in Jörg Stülke's lab PubMed Two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab, PubMed FLAG-tag construct
References
Reviews
Loading
Original publications
Loading
Labs working on this gene/protein